ID: 1151373483 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:73665970-73665992 |
| Sequence | ATGATACTTGCCAAGTTGAG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1151373479_1151373483 | 25 | Left | 1151373479 | 17:73665922-73665944 | CCGGCACCTAGTAGGTGTTTCAT | No data | ||
| Right | 1151373483 | 17:73665970-73665992 | ATGATACTTGCCAAGTTGAGAGG | No data | ||||
| 1151373480_1151373483 | 19 | Left | 1151373480 | 17:73665928-73665950 | CCTAGTAGGTGTTTCATAAATCC | No data | ||
| Right | 1151373483 | 17:73665970-73665992 | ATGATACTTGCCAAGTTGAGAGG | No data | ||||
| 1151373482_1151373483 | -2 | Left | 1151373482 | 17:73665949-73665971 | CCAAGTTCAGGCTTTATTATTAT | No data | ||
| Right | 1151373483 | 17:73665970-73665992 | ATGATACTTGCCAAGTTGAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1151373483 | Original CRISPR | ATGATACTTGCCAAGTTGAG AGG | Intergenic | ||