ID: 1151373484

View in Genome Browser
Species Human (GRCh38)
Location 17:73665975-73665997
Sequence ACTTGCCAAGTTGAGAGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151373479_1151373484 30 Left 1151373479 17:73665922-73665944 CCGGCACCTAGTAGGTGTTTCAT No data
Right 1151373484 17:73665975-73665997 ACTTGCCAAGTTGAGAGGTCAGG No data
1151373482_1151373484 3 Left 1151373482 17:73665949-73665971 CCAAGTTCAGGCTTTATTATTAT No data
Right 1151373484 17:73665975-73665997 ACTTGCCAAGTTGAGAGGTCAGG No data
1151373480_1151373484 24 Left 1151373480 17:73665928-73665950 CCTAGTAGGTGTTTCATAAATCC No data
Right 1151373484 17:73665975-73665997 ACTTGCCAAGTTGAGAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151373484 Original CRISPR ACTTGCCAAGTTGAGAGGTC AGG Intergenic