ID: 1151373510

View in Genome Browser
Species Human (GRCh38)
Location 17:73666174-73666196
Sequence GTGTTGGAGGAGAAGCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151373500_1151373510 11 Left 1151373500 17:73666140-73666162 CCCACCCAAATCTCATGAGAAAT No data
Right 1151373510 17:73666174-73666196 GTGTTGGAGGAGAAGCCTGGTGG No data
1151373502_1151373510 7 Left 1151373502 17:73666144-73666166 CCCAAATCTCATGAGAAATTGTA No data
Right 1151373510 17:73666174-73666196 GTGTTGGAGGAGAAGCCTGGTGG No data
1151373501_1151373510 10 Left 1151373501 17:73666141-73666163 CCACCCAAATCTCATGAGAAATT No data
Right 1151373510 17:73666174-73666196 GTGTTGGAGGAGAAGCCTGGTGG No data
1151373503_1151373510 6 Left 1151373503 17:73666145-73666167 CCAAATCTCATGAGAAATTGTAA No data
Right 1151373510 17:73666174-73666196 GTGTTGGAGGAGAAGCCTGGTGG No data
1151373499_1151373510 12 Left 1151373499 17:73666139-73666161 CCCCACCCAAATCTCATGAGAAA No data
Right 1151373510 17:73666174-73666196 GTGTTGGAGGAGAAGCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151373510 Original CRISPR GTGTTGGAGGAGAAGCCTGG TGG Intergenic
No off target data available for this crispr