ID: 1151377057

View in Genome Browser
Species Human (GRCh38)
Location 17:73697115-73697137
Sequence TGTGTGGTTGTGTATACATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151377057_1151377065 14 Left 1151377057 17:73697115-73697137 CCACATGTATACACAACCACACA No data
Right 1151377065 17:73697152-73697174 CAGCACACACTGGGCTTGGGGGG No data
1151377057_1151377062 11 Left 1151377057 17:73697115-73697137 CCACATGTATACACAACCACACA No data
Right 1151377062 17:73697149-73697171 ACACAGCACACACTGGGCTTGGG No data
1151377057_1151377063 12 Left 1151377057 17:73697115-73697137 CCACATGTATACACAACCACACA No data
Right 1151377063 17:73697150-73697172 CACAGCACACACTGGGCTTGGGG No data
1151377057_1151377060 5 Left 1151377057 17:73697115-73697137 CCACATGTATACACAACCACACA No data
Right 1151377060 17:73697143-73697165 GCATGCACACAGCACACACTGGG No data
1151377057_1151377061 10 Left 1151377057 17:73697115-73697137 CCACATGTATACACAACCACACA No data
Right 1151377061 17:73697148-73697170 CACACAGCACACACTGGGCTTGG No data
1151377057_1151377066 21 Left 1151377057 17:73697115-73697137 CCACATGTATACACAACCACACA No data
Right 1151377066 17:73697159-73697181 CACTGGGCTTGGGGGGTCTTTGG No data
1151377057_1151377064 13 Left 1151377057 17:73697115-73697137 CCACATGTATACACAACCACACA No data
Right 1151377064 17:73697151-73697173 ACAGCACACACTGGGCTTGGGGG No data
1151377057_1151377059 4 Left 1151377057 17:73697115-73697137 CCACATGTATACACAACCACACA No data
Right 1151377059 17:73697142-73697164 TGCATGCACACAGCACACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151377057 Original CRISPR TGTGTGGTTGTGTATACATG TGG (reversed) Intergenic