ID: 1151377058

View in Genome Browser
Species Human (GRCh38)
Location 17:73697131-73697153
Sequence TGTGTGCATGCACAAATGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151377058_1151377063 -4 Left 1151377058 17:73697131-73697153 CCACACATTTGTGCATGCACACA No data
Right 1151377063 17:73697150-73697172 CACAGCACACACTGGGCTTGGGG No data
1151377058_1151377061 -6 Left 1151377058 17:73697131-73697153 CCACACATTTGTGCATGCACACA No data
Right 1151377061 17:73697148-73697170 CACACAGCACACACTGGGCTTGG No data
1151377058_1151377064 -3 Left 1151377058 17:73697131-73697153 CCACACATTTGTGCATGCACACA No data
Right 1151377064 17:73697151-73697173 ACAGCACACACTGGGCTTGGGGG No data
1151377058_1151377066 5 Left 1151377058 17:73697131-73697153 CCACACATTTGTGCATGCACACA No data
Right 1151377066 17:73697159-73697181 CACTGGGCTTGGGGGGTCTTTGG No data
1151377058_1151377065 -2 Left 1151377058 17:73697131-73697153 CCACACATTTGTGCATGCACACA No data
Right 1151377065 17:73697152-73697174 CAGCACACACTGGGCTTGGGGGG No data
1151377058_1151377062 -5 Left 1151377058 17:73697131-73697153 CCACACATTTGTGCATGCACACA No data
Right 1151377062 17:73697149-73697171 ACACAGCACACACTGGGCTTGGG No data
1151377058_1151377067 28 Left 1151377058 17:73697131-73697153 CCACACATTTGTGCATGCACACA No data
Right 1151377067 17:73697182-73697204 CATGACATCTCCCCTCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151377058 Original CRISPR TGTGTGCATGCACAAATGTG TGG (reversed) Intergenic