ID: 1151377059 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:73697142-73697164 |
Sequence | TGCATGCACACAGCACACAC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1151377057_1151377059 | 4 | Left | 1151377057 | 17:73697115-73697137 | CCACATGTATACACAACCACACA | No data | ||
Right | 1151377059 | 17:73697142-73697164 | TGCATGCACACAGCACACACTGG | No data | ||||
1151377056_1151377059 | 27 | Left | 1151377056 | 17:73697092-73697114 | CCACACACATGCATGCACACACA | No data | ||
Right | 1151377059 | 17:73697142-73697164 | TGCATGCACACAGCACACACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1151377059 | Original CRISPR | TGCATGCACACAGCACACAC TGG | Intergenic | ||