ID: 1151377061 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:73697148-73697170 |
| Sequence | CACACAGCACACACTGGGCT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1151377058_1151377061 | -6 | Left | 1151377058 | 17:73697131-73697153 | CCACACATTTGTGCATGCACACA | No data | ||
| Right | 1151377061 | 17:73697148-73697170 | CACACAGCACACACTGGGCTTGG | No data | ||||
| 1151377057_1151377061 | 10 | Left | 1151377057 | 17:73697115-73697137 | CCACATGTATACACAACCACACA | No data | ||
| Right | 1151377061 | 17:73697148-73697170 | CACACAGCACACACTGGGCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1151377061 | Original CRISPR | CACACAGCACACACTGGGCT TGG | Intergenic | ||