ID: 1151377063 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:73697150-73697172 |
Sequence | CACAGCACACACTGGGCTTG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1151377057_1151377063 | 12 | Left | 1151377057 | 17:73697115-73697137 | CCACATGTATACACAACCACACA | No data | ||
Right | 1151377063 | 17:73697150-73697172 | CACAGCACACACTGGGCTTGGGG | No data | ||||
1151377058_1151377063 | -4 | Left | 1151377058 | 17:73697131-73697153 | CCACACATTTGTGCATGCACACA | No data | ||
Right | 1151377063 | 17:73697150-73697172 | CACAGCACACACTGGGCTTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1151377063 | Original CRISPR | CACAGCACACACTGGGCTTG GGG | Intergenic | ||