ID: 1151377066

View in Genome Browser
Species Human (GRCh38)
Location 17:73697159-73697181
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151377058_1151377066 5 Left 1151377058 17:73697131-73697153 CCACACATTTGTGCATGCACACA No data
Right 1151377066 17:73697159-73697181 CACTGGGCTTGGGGGGTCTTTGG No data
1151377057_1151377066 21 Left 1151377057 17:73697115-73697137 CCACATGTATACACAACCACACA No data
Right 1151377066 17:73697159-73697181 CACTGGGCTTGGGGGGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151377066 Original CRISPR CACTGGGCTTGGGGGGTCTT TGG Intergenic
No off target data available for this crispr