ID: 1151377793

View in Genome Browser
Species Human (GRCh38)
Location 17:73703244-73703266
Sequence CACTACAGGCCTACACTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151377793_1151377796 1 Left 1151377793 17:73703244-73703266 CCTTCCAGTGTAGGCCTGTAGTG No data
Right 1151377796 17:73703268-73703290 TCCCAACCCATCTGACCAGCAGG No data
1151377793_1151377802 10 Left 1151377793 17:73703244-73703266 CCTTCCAGTGTAGGCCTGTAGTG No data
Right 1151377802 17:73703277-73703299 ATCTGACCAGCAGGCTCTGTGGG No data
1151377793_1151377801 9 Left 1151377793 17:73703244-73703266 CCTTCCAGTGTAGGCCTGTAGTG No data
Right 1151377801 17:73703276-73703298 CATCTGACCAGCAGGCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151377793 Original CRISPR CACTACAGGCCTACACTGGA AGG (reversed) Intergenic
No off target data available for this crispr