ID: 1151377801

View in Genome Browser
Species Human (GRCh38)
Location 17:73703276-73703298
Sequence CATCTGACCAGCAGGCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151377792_1151377801 16 Left 1151377792 17:73703237-73703259 CCTGGGTCCTTCCAGTGTAGGCC No data
Right 1151377801 17:73703276-73703298 CATCTGACCAGCAGGCTCTGTGG No data
1151377795_1151377801 -5 Left 1151377795 17:73703258-73703280 CCTGTAGTGTTCCCAACCCATCT No data
Right 1151377801 17:73703276-73703298 CATCTGACCAGCAGGCTCTGTGG No data
1151377794_1151377801 5 Left 1151377794 17:73703248-73703270 CCAGTGTAGGCCTGTAGTGTTCC No data
Right 1151377801 17:73703276-73703298 CATCTGACCAGCAGGCTCTGTGG No data
1151377793_1151377801 9 Left 1151377793 17:73703244-73703266 CCTTCCAGTGTAGGCCTGTAGTG No data
Right 1151377801 17:73703276-73703298 CATCTGACCAGCAGGCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151377801 Original CRISPR CATCTGACCAGCAGGCTCTG TGG Intergenic
No off target data available for this crispr