ID: 1151378010

View in Genome Browser
Species Human (GRCh38)
Location 17:73704778-73704800
Sequence TGTAGGAGATCCAAGTGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151378008_1151378010 8 Left 1151378008 17:73704747-73704769 CCACTGTCTGGCTGACATCTGAC No data
Right 1151378010 17:73704778-73704800 TGTAGGAGATCCAAGTGCCTAGG No data
1151378007_1151378010 19 Left 1151378007 17:73704736-73704758 CCTTCAGATGACCACTGTCTGGC No data
Right 1151378010 17:73704778-73704800 TGTAGGAGATCCAAGTGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151378010 Original CRISPR TGTAGGAGATCCAAGTGCCT AGG Intergenic
No off target data available for this crispr