ID: 1151378594

View in Genome Browser
Species Human (GRCh38)
Location 17:73708977-73708999
Sequence CATTTTCTCCAGAGGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151378594_1151378603 17 Left 1151378594 17:73708977-73708999 CCAACTTCCCTCTGGAGAAAATG No data
Right 1151378603 17:73709017-73709039 GGTCAGCCTTGGTACCCACTGGG No data
1151378594_1151378602 16 Left 1151378594 17:73708977-73708999 CCAACTTCCCTCTGGAGAAAATG No data
Right 1151378602 17:73709016-73709038 TGGTCAGCCTTGGTACCCACTGG No data
1151378594_1151378599 6 Left 1151378594 17:73708977-73708999 CCAACTTCCCTCTGGAGAAAATG No data
Right 1151378599 17:73709006-73709028 ACCAGTGTCCTGGTCAGCCTTGG No data
1151378594_1151378598 -4 Left 1151378594 17:73708977-73708999 CCAACTTCCCTCTGGAGAAAATG No data
Right 1151378598 17:73708996-73709018 AATGGACAGTACCAGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151378594 Original CRISPR CATTTTCTCCAGAGGGAAGT TGG (reversed) Intergenic
No off target data available for this crispr