ID: 1151381793

View in Genome Browser
Species Human (GRCh38)
Location 17:73730786-73730808
Sequence TTCTATGGGAATGCACAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151381793_1151381797 7 Left 1151381793 17:73730786-73730808 CCATCCTGTGCATTCCCATAGAA No data
Right 1151381797 17:73730816-73730838 AATGATGCCCACATTCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151381793 Original CRISPR TTCTATGGGAATGCACAGGA TGG (reversed) Intergenic
No off target data available for this crispr