ID: 1151383570

View in Genome Browser
Species Human (GRCh38)
Location 17:73741756-73741778
Sequence GAGAAAAAGAAAAAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151383570_1151383573 28 Left 1151383570 17:73741756-73741778 CCTGCCTCCTTTTTCTTTTTCTC No data
Right 1151383573 17:73741807-73741829 TTCTTTTTAGAAGAAGTAACAGG No data
1151383570_1151383574 29 Left 1151383570 17:73741756-73741778 CCTGCCTCCTTTTTCTTTTTCTC No data
Right 1151383574 17:73741808-73741830 TCTTTTTAGAAGAAGTAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151383570 Original CRISPR GAGAAAAAGAAAAAGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr