ID: 1151384816

View in Genome Browser
Species Human (GRCh38)
Location 17:73748587-73748609
Sequence GTCCTTCAGCAGCCCGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151384813_1151384816 -7 Left 1151384813 17:73748571-73748593 CCTTGTGTGGGGCTTCGTCCTTC No data
Right 1151384816 17:73748587-73748609 GTCCTTCAGCAGCCCGGTGAGGG No data
1151384809_1151384816 17 Left 1151384809 17:73748547-73748569 CCGGGACAGCTGTAAACTCTTTA No data
Right 1151384816 17:73748587-73748609 GTCCTTCAGCAGCCCGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151384816 Original CRISPR GTCCTTCAGCAGCCCGGTGA GGG Intergenic
No off target data available for this crispr