ID: 1151385656

View in Genome Browser
Species Human (GRCh38)
Location 17:73753749-73753771
Sequence GGGATAGTGCCCCCTGGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151385656_1151385666 15 Left 1151385656 17:73753749-73753771 CCAATCCCAGGGGGCACTATCCC No data
Right 1151385666 17:73753787-73753809 GCATGGTGAATAAGGTGCAGTGG No data
1151385656_1151385668 30 Left 1151385656 17:73753749-73753771 CCAATCCCAGGGGGCACTATCCC No data
Right 1151385668 17:73753802-73753824 TGCAGTGGCTGAGACCCTCAGGG No data
1151385656_1151385662 -2 Left 1151385656 17:73753749-73753771 CCAATCCCAGGGGGCACTATCCC No data
Right 1151385662 17:73753770-73753792 CCTGGATACTCTCCCATGCATGG No data
1151385656_1151385667 29 Left 1151385656 17:73753749-73753771 CCAATCCCAGGGGGCACTATCCC No data
Right 1151385667 17:73753801-73753823 GTGCAGTGGCTGAGACCCTCAGG No data
1151385656_1151385663 7 Left 1151385656 17:73753749-73753771 CCAATCCCAGGGGGCACTATCCC No data
Right 1151385663 17:73753779-73753801 TCTCCCATGCATGGTGAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151385656 Original CRISPR GGGATAGTGCCCCCTGGGAT TGG (reversed) Intergenic