ID: 1151396392

View in Genome Browser
Species Human (GRCh38)
Location 17:73826018-73826040
Sequence TATCGTCCACATTAATAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151396390_1151396392 -3 Left 1151396390 17:73825998-73826020 CCCTAAGAGGTAGGGACTGTTAT No data
Right 1151396392 17:73826018-73826040 TATCGTCCACATTAATAGACAGG No data
1151396387_1151396392 6 Left 1151396387 17:73825989-73826011 CCATGGTAACCCTAAGAGGTAGG No data
Right 1151396392 17:73826018-73826040 TATCGTCCACATTAATAGACAGG No data
1151396386_1151396392 7 Left 1151396386 17:73825988-73826010 CCCATGGTAACCCTAAGAGGTAG No data
Right 1151396392 17:73826018-73826040 TATCGTCCACATTAATAGACAGG No data
1151396391_1151396392 -4 Left 1151396391 17:73825999-73826021 CCTAAGAGGTAGGGACTGTTATC No data
Right 1151396392 17:73826018-73826040 TATCGTCCACATTAATAGACAGG No data
1151396383_1151396392 19 Left 1151396383 17:73825976-73825998 CCAGATTTAATCCCCATGGTAAC No data
Right 1151396392 17:73826018-73826040 TATCGTCCACATTAATAGACAGG No data
1151396385_1151396392 8 Left 1151396385 17:73825987-73826009 CCCCATGGTAACCCTAAGAGGTA No data
Right 1151396392 17:73826018-73826040 TATCGTCCACATTAATAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151396392 Original CRISPR TATCGTCCACATTAATAGAC AGG Intergenic
No off target data available for this crispr