ID: 1151397737

View in Genome Browser
Species Human (GRCh38)
Location 17:73835402-73835424
Sequence GATCACCGGTGGTTTCCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151397730_1151397737 3 Left 1151397730 17:73835376-73835398 CCATCATCCTCATGAACCATGAC No data
Right 1151397737 17:73835402-73835424 GATCACCGGTGGTTTCCTAGAGG No data
1151397729_1151397737 4 Left 1151397729 17:73835375-73835397 CCCATCATCCTCATGAACCATGA No data
Right 1151397737 17:73835402-73835424 GATCACCGGTGGTTTCCTAGAGG No data
1151397731_1151397737 -4 Left 1151397731 17:73835383-73835405 CCTCATGAACCATGACCCTGATC No data
Right 1151397737 17:73835402-73835424 GATCACCGGTGGTTTCCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151397737 Original CRISPR GATCACCGGTGGTTTCCTAG AGG Intergenic
No off target data available for this crispr