ID: 1151400211

View in Genome Browser
Species Human (GRCh38)
Location 17:73850962-73850984
Sequence GAGGTTAAACAACCTGCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151400211_1151400217 26 Left 1151400211 17:73850962-73850984 CCTTGAGCAGGTTGTTTAACCTC No data
Right 1151400217 17:73851011-73851033 AAATGGGAATAATAACACCATGG No data
1151400211_1151400215 9 Left 1151400211 17:73850962-73850984 CCTTGAGCAGGTTGTTTAACCTC No data
Right 1151400215 17:73850994-73851016 CAGTTTTCTGAACGGTAAAATGG No data
1151400211_1151400213 1 Left 1151400211 17:73850962-73850984 CCTTGAGCAGGTTGTTTAACCTC No data
Right 1151400213 17:73850986-73851008 TTATGCCTCAGTTTTCTGAACGG No data
1151400211_1151400216 10 Left 1151400211 17:73850962-73850984 CCTTGAGCAGGTTGTTTAACCTC No data
Right 1151400216 17:73850995-73851017 AGTTTTCTGAACGGTAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151400211 Original CRISPR GAGGTTAAACAACCTGCTCA AGG (reversed) Intergenic
No off target data available for this crispr