ID: 1151401111

View in Genome Browser
Species Human (GRCh38)
Location 17:73856753-73856775
Sequence CTCTCTCCACAGATGTAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151401109_1151401111 1 Left 1151401109 17:73856729-73856751 CCTGCTCATCTGTGAGGCTTGAG No data
Right 1151401111 17:73856753-73856775 CTCTCTCCACAGATGTAATCAGG No data
1151401107_1151401111 18 Left 1151401107 17:73856712-73856734 CCAGGCTGATCGATAAGCCTGCT No data
Right 1151401111 17:73856753-73856775 CTCTCTCCACAGATGTAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151401111 Original CRISPR CTCTCTCCACAGATGTAATC AGG Intergenic
No off target data available for this crispr