ID: 1151403494

View in Genome Browser
Species Human (GRCh38)
Location 17:73871667-73871689
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151403491_1151403494 0 Left 1151403491 17:73871644-73871666 CCATTGGTGCAGCGTCCCTGCTG No data
Right 1151403494 17:73871667-73871689 CACCTGAGCCTGCAGCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151403494 Original CRISPR CACCTGAGCCTGCAGCAGCA AGG Intergenic
No off target data available for this crispr