ID: 1151404688

View in Genome Browser
Species Human (GRCh38)
Location 17:73878696-73878718
Sequence GGGTAAATACAGAGGAAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151404679_1151404688 9 Left 1151404679 17:73878664-73878686 CCAGCACCAGAAAGACCTGGACC No data
Right 1151404688 17:73878696-73878718 GGGTAAATACAGAGGAAGCAAGG No data
1151404685_1151404688 -6 Left 1151404685 17:73878679-73878701 CCTGGACCAAAGGAGGTGGGTAA No data
Right 1151404688 17:73878696-73878718 GGGTAAATACAGAGGAAGCAAGG No data
1151404681_1151404688 3 Left 1151404681 17:73878670-73878692 CCAGAAAGACCTGGACCAAAGGA No data
Right 1151404688 17:73878696-73878718 GGGTAAATACAGAGGAAGCAAGG No data
1151404676_1151404688 21 Left 1151404676 17:73878652-73878674 CCACCATCTACTCCAGCACCAGA No data
Right 1151404688 17:73878696-73878718 GGGTAAATACAGAGGAAGCAAGG No data
1151404673_1151404688 28 Left 1151404673 17:73878645-73878667 CCAATCCCCACCATCTACTCCAG No data
Right 1151404688 17:73878696-73878718 GGGTAAATACAGAGGAAGCAAGG No data
1151404677_1151404688 18 Left 1151404677 17:73878655-73878677 CCATCTACTCCAGCACCAGAAAG No data
Right 1151404688 17:73878696-73878718 GGGTAAATACAGAGGAAGCAAGG No data
1151404675_1151404688 22 Left 1151404675 17:73878651-73878673 CCCACCATCTACTCCAGCACCAG No data
Right 1151404688 17:73878696-73878718 GGGTAAATACAGAGGAAGCAAGG No data
1151404674_1151404688 23 Left 1151404674 17:73878650-73878672 CCCCACCATCTACTCCAGCACCA No data
Right 1151404688 17:73878696-73878718 GGGTAAATACAGAGGAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151404688 Original CRISPR GGGTAAATACAGAGGAAGCA AGG Intergenic
No off target data available for this crispr