ID: 1151405391

View in Genome Browser
Species Human (GRCh38)
Location 17:73882810-73882832
Sequence CCGTGCTCACGCACCCTCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151405386_1151405391 -4 Left 1151405386 17:73882791-73882813 CCATGAGCAGTGCATGTGTCCGT No data
Right 1151405391 17:73882810-73882832 CCGTGCTCACGCACCCTCGGGGG No data
1151405385_1151405391 20 Left 1151405385 17:73882767-73882789 CCATCTGCTGAGGAGCACGTGTG No data
Right 1151405391 17:73882810-73882832 CCGTGCTCACGCACCCTCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151405391 Original CRISPR CCGTGCTCACGCACCCTCGG GGG Intergenic
No off target data available for this crispr