ID: 1151407488

View in Genome Browser
Species Human (GRCh38)
Location 17:73898682-73898704
Sequence AACCCCCGTGGGTGGAAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151407488_1151407495 -6 Left 1151407488 17:73898682-73898704 CCAAACTTCCACCCACGGGGGTT No data
Right 1151407495 17:73898699-73898721 GGGGTTCAGGGTCAAGGACTTGG No data
1151407488_1151407496 3 Left 1151407488 17:73898682-73898704 CCAAACTTCCACCCACGGGGGTT No data
Right 1151407496 17:73898708-73898730 GGTCAAGGACTTGGAGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151407488 Original CRISPR AACCCCCGTGGGTGGAAGTT TGG (reversed) Intergenic