ID: 1151407492

View in Genome Browser
Species Human (GRCh38)
Location 17:73898693-73898715
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151407492_1151407496 -8 Left 1151407492 17:73898693-73898715 CCCACGGGGGTTCAGGGTCAAGG No data
Right 1151407496 17:73898708-73898730 GGTCAAGGACTTGGAGTTGCAGG No data
1151407492_1151407499 25 Left 1151407492 17:73898693-73898715 CCCACGGGGGTTCAGGGTCAAGG No data
Right 1151407499 17:73898741-73898763 TTTACTAGCTCTCCAATTTTGGG No data
1151407492_1151407498 24 Left 1151407492 17:73898693-73898715 CCCACGGGGGTTCAGGGTCAAGG No data
Right 1151407498 17:73898740-73898762 ATTTACTAGCTCTCCAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151407492 Original CRISPR CCTTGACCCTGAACCCCCGT GGG (reversed) Intergenic