ID: 1151407494

View in Genome Browser
Species Human (GRCh38)
Location 17:73898694-73898716
Sequence TCCTTGACCCTGAACCCCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151407494_1151407498 23 Left 1151407494 17:73898694-73898716 CCACGGGGGTTCAGGGTCAAGGA No data
Right 1151407498 17:73898740-73898762 ATTTACTAGCTCTCCAATTTTGG No data
1151407494_1151407496 -9 Left 1151407494 17:73898694-73898716 CCACGGGGGTTCAGGGTCAAGGA No data
Right 1151407496 17:73898708-73898730 GGTCAAGGACTTGGAGTTGCAGG No data
1151407494_1151407499 24 Left 1151407494 17:73898694-73898716 CCACGGGGGTTCAGGGTCAAGGA No data
Right 1151407499 17:73898741-73898763 TTTACTAGCTCTCCAATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151407494 Original CRISPR TCCTTGACCCTGAACCCCCG TGG (reversed) Intergenic