ID: 1151407496

View in Genome Browser
Species Human (GRCh38)
Location 17:73898708-73898730
Sequence GGTCAAGGACTTGGAGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151407494_1151407496 -9 Left 1151407494 17:73898694-73898716 CCACGGGGGTTCAGGGTCAAGGA No data
Right 1151407496 17:73898708-73898730 GGTCAAGGACTTGGAGTTGCAGG No data
1151407491_1151407496 -5 Left 1151407491 17:73898690-73898712 CCACCCACGGGGGTTCAGGGTCA No data
Right 1151407496 17:73898708-73898730 GGTCAAGGACTTGGAGTTGCAGG No data
1151407488_1151407496 3 Left 1151407488 17:73898682-73898704 CCAAACTTCCACCCACGGGGGTT No data
Right 1151407496 17:73898708-73898730 GGTCAAGGACTTGGAGTTGCAGG No data
1151407492_1151407496 -8 Left 1151407492 17:73898693-73898715 CCCACGGGGGTTCAGGGTCAAGG No data
Right 1151407496 17:73898708-73898730 GGTCAAGGACTTGGAGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151407496 Original CRISPR GGTCAAGGACTTGGAGTTGC AGG Intergenic