ID: 1151407498

View in Genome Browser
Species Human (GRCh38)
Location 17:73898740-73898762
Sequence ATTTACTAGCTCTCCAATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151407492_1151407498 24 Left 1151407492 17:73898693-73898715 CCCACGGGGGTTCAGGGTCAAGG No data
Right 1151407498 17:73898740-73898762 ATTTACTAGCTCTCCAATTTTGG No data
1151407494_1151407498 23 Left 1151407494 17:73898694-73898716 CCACGGGGGTTCAGGGTCAAGGA No data
Right 1151407498 17:73898740-73898762 ATTTACTAGCTCTCCAATTTTGG No data
1151407491_1151407498 27 Left 1151407491 17:73898690-73898712 CCACCCACGGGGGTTCAGGGTCA No data
Right 1151407498 17:73898740-73898762 ATTTACTAGCTCTCCAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151407498 Original CRISPR ATTTACTAGCTCTCCAATTT TGG Intergenic