ID: 1151413748

View in Genome Browser
Species Human (GRCh38)
Location 17:73948126-73948148
Sequence TGGACATGGGACAGGCTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151413740_1151413748 4 Left 1151413740 17:73948099-73948121 CCCAAGGAGCAGATGCCAAGACA No data
Right 1151413748 17:73948126-73948148 TGGACATGGGACAGGCTTACTGG No data
1151413741_1151413748 3 Left 1151413741 17:73948100-73948122 CCAAGGAGCAGATGCCAAGACAG No data
Right 1151413748 17:73948126-73948148 TGGACATGGGACAGGCTTACTGG No data
1151413738_1151413748 25 Left 1151413738 17:73948078-73948100 CCATTGTGTCGCTTTGGATGTCC No data
Right 1151413748 17:73948126-73948148 TGGACATGGGACAGGCTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151413748 Original CRISPR TGGACATGGGACAGGCTTAC TGG Intergenic
No off target data available for this crispr