ID: 1151416806

View in Genome Browser
Species Human (GRCh38)
Location 17:73971942-73971964
Sequence CATGCTATAGATTAGGGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151416806_1151416812 -9 Left 1151416806 17:73971942-73971964 CCAAGACCCTAATCTATAGCATG No data
Right 1151416812 17:73971956-73971978 TATAGCATGGGGTCCCCATCTGG No data
1151416806_1151416817 26 Left 1151416806 17:73971942-73971964 CCAAGACCCTAATCTATAGCATG No data
Right 1151416817 17:73971991-73972013 CAATGAGTGCCGAGTAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151416806 Original CRISPR CATGCTATAGATTAGGGTCT TGG (reversed) Intergenic
No off target data available for this crispr