ID: 1151416816

View in Genome Browser
Species Human (GRCh38)
Location 17:73971990-73972012
Sequence CACTTCTACTCGGCACTCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151416816_1151416820 3 Left 1151416816 17:73971990-73972012 CCAATGAGTGCCGAGTAGAAGTG No data
Right 1151416820 17:73972016-73972038 CCTATCCTCCTATGCTCCTCAGG No data
1151416816_1151416822 8 Left 1151416816 17:73971990-73972012 CCAATGAGTGCCGAGTAGAAGTG No data
Right 1151416822 17:73972021-73972043 CCTCCTATGCTCCTCAGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151416816 Original CRISPR CACTTCTACTCGGCACTCAT TGG (reversed) Intergenic
No off target data available for this crispr