ID: 1151416817

View in Genome Browser
Species Human (GRCh38)
Location 17:73971991-73972013
Sequence CAATGAGTGCCGAGTAGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151416815_1151416817 -3 Left 1151416815 17:73971971-73971993 CCATCTGGACAATGATGCACCAA No data
Right 1151416817 17:73971991-73972013 CAATGAGTGCCGAGTAGAAGTGG No data
1151416810_1151416817 20 Left 1151416810 17:73971948-73971970 CCCTAATCTATAGCATGGGGTCC No data
Right 1151416817 17:73971991-73972013 CAATGAGTGCCGAGTAGAAGTGG No data
1151416806_1151416817 26 Left 1151416806 17:73971942-73971964 CCAAGACCCTAATCTATAGCATG No data
Right 1151416817 17:73971991-73972013 CAATGAGTGCCGAGTAGAAGTGG No data
1151416813_1151416817 -1 Left 1151416813 17:73971969-73971991 CCCCATCTGGACAATGATGCACC No data
Right 1151416817 17:73971991-73972013 CAATGAGTGCCGAGTAGAAGTGG No data
1151416811_1151416817 19 Left 1151416811 17:73971949-73971971 CCTAATCTATAGCATGGGGTCCC No data
Right 1151416817 17:73971991-73972013 CAATGAGTGCCGAGTAGAAGTGG No data
1151416814_1151416817 -2 Left 1151416814 17:73971970-73971992 CCCATCTGGACAATGATGCACCA No data
Right 1151416817 17:73971991-73972013 CAATGAGTGCCGAGTAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151416817 Original CRISPR CAATGAGTGCCGAGTAGAAG TGG Intergenic
No off target data available for this crispr