ID: 1151416822

View in Genome Browser
Species Human (GRCh38)
Location 17:73972021-73972043
Sequence CCTCCTATGCTCCTCAGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151416815_1151416822 27 Left 1151416815 17:73971971-73971993 CCATCTGGACAATGATGCACCAA No data
Right 1151416822 17:73972021-73972043 CCTCCTATGCTCCTCAGGATAGG No data
1151416814_1151416822 28 Left 1151416814 17:73971970-73971992 CCCATCTGGACAATGATGCACCA No data
Right 1151416822 17:73972021-73972043 CCTCCTATGCTCCTCAGGATAGG No data
1151416813_1151416822 29 Left 1151416813 17:73971969-73971991 CCCCATCTGGACAATGATGCACC No data
Right 1151416822 17:73972021-73972043 CCTCCTATGCTCCTCAGGATAGG No data
1151416818_1151416822 -2 Left 1151416818 17:73972000-73972022 CCGAGTAGAAGTGGATCCTATCC No data
Right 1151416822 17:73972021-73972043 CCTCCTATGCTCCTCAGGATAGG No data
1151416816_1151416822 8 Left 1151416816 17:73971990-73972012 CCAATGAGTGCCGAGTAGAAGTG No data
Right 1151416822 17:73972021-73972043 CCTCCTATGCTCCTCAGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151416822 Original CRISPR CCTCCTATGCTCCTCAGGAT AGG Intergenic
No off target data available for this crispr