ID: 1151416989

View in Genome Browser
Species Human (GRCh38)
Location 17:73973018-73973040
Sequence GATTCAGGAGAGGTCCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151416989_1151416995 -2 Left 1151416989 17:73973018-73973040 CCTGGCTGGACCTCTCCTGAATC No data
Right 1151416995 17:73973039-73973061 TCCCAGGGCAGACAGAGGTTAGG No data
1151416989_1151416997 -1 Left 1151416989 17:73973018-73973040 CCTGGCTGGACCTCTCCTGAATC No data
Right 1151416997 17:73973040-73973062 CCCAGGGCAGACAGAGGTTAGGG No data
1151416989_1151416994 -7 Left 1151416989 17:73973018-73973040 CCTGGCTGGACCTCTCCTGAATC No data
Right 1151416994 17:73973034-73973056 CTGAATCCCAGGGCAGACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151416989 Original CRISPR GATTCAGGAGAGGTCCAGCC AGG (reversed) Intergenic
No off target data available for this crispr