ID: 1151417907

View in Genome Browser
Species Human (GRCh38)
Location 17:73978622-73978644
Sequence CAGCTTTTCCTGTGGGCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151417907_1151417914 8 Left 1151417907 17:73978622-73978644 CCATAGGCCCACAGGAAAAGCTG No data
Right 1151417914 17:73978653-73978675 GGCGAAAAACACTAGATTTTGGG No data
1151417907_1151417913 7 Left 1151417907 17:73978622-73978644 CCATAGGCCCACAGGAAAAGCTG No data
Right 1151417913 17:73978652-73978674 GGGCGAAAAACACTAGATTTTGG No data
1151417907_1151417916 23 Left 1151417907 17:73978622-73978644 CCATAGGCCCACAGGAAAAGCTG No data
Right 1151417916 17:73978668-73978690 ATTTTGGGAAAGTTATAAGCGGG No data
1151417907_1151417915 22 Left 1151417907 17:73978622-73978644 CCATAGGCCCACAGGAAAAGCTG No data
Right 1151417915 17:73978667-73978689 GATTTTGGGAAAGTTATAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151417907 Original CRISPR CAGCTTTTCCTGTGGGCCTA TGG (reversed) Intergenic
No off target data available for this crispr