ID: 1151418951

View in Genome Browser
Species Human (GRCh38)
Location 17:73985003-73985025
Sequence TTTAATAAACGTGAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151418951_1151418961 20 Left 1151418951 17:73985003-73985025 CCATCCACCTCACGTTTATTAAA No data
Right 1151418961 17:73985046-73985068 GGATGCGAGCACCTCCACCAGGG No data
1151418951_1151418960 19 Left 1151418951 17:73985003-73985025 CCATCCACCTCACGTTTATTAAA No data
Right 1151418960 17:73985045-73985067 GGGATGCGAGCACCTCCACCAGG No data
1151418951_1151418956 -1 Left 1151418951 17:73985003-73985025 CCATCCACCTCACGTTTATTAAA No data
Right 1151418956 17:73985025-73985047 AGGCCTACTATGTGCCCAATGGG No data
1151418951_1151418955 -2 Left 1151418951 17:73985003-73985025 CCATCCACCTCACGTTTATTAAA No data
Right 1151418955 17:73985024-73985046 AAGGCCTACTATGTGCCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151418951 Original CRISPR TTTAATAAACGTGAGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr