ID: 1151421506

View in Genome Browser
Species Human (GRCh38)
Location 17:74001038-74001060
Sequence GGGGGTGACCAGAACAGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151421506_1151421514 28 Left 1151421506 17:74001038-74001060 CCAGAACTGTTCTGGTCACCCCC No data
Right 1151421514 17:74001089-74001111 AATCTTCCAGATAAACGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151421506 Original CRISPR GGGGGTGACCAGAACAGTTC TGG (reversed) Intergenic
No off target data available for this crispr