ID: 1151422997

View in Genome Browser
Species Human (GRCh38)
Location 17:74010833-74010855
Sequence TCTGATATCCAGAATCTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151422996_1151422997 -9 Left 1151422996 17:74010819-74010841 CCATCTGGCAAAGGTCTGATATC No data
Right 1151422997 17:74010833-74010855 TCTGATATCCAGAATCTAGAAGG No data
1151422992_1151422997 24 Left 1151422992 17:74010786-74010808 CCTACAGACTGAGAGAAAATGTT No data
Right 1151422997 17:74010833-74010855 TCTGATATCCAGAATCTAGAAGG No data
1151422995_1151422997 -8 Left 1151422995 17:74010818-74010840 CCCATCTGGCAAAGGTCTGATAT No data
Right 1151422997 17:74010833-74010855 TCTGATATCCAGAATCTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151422997 Original CRISPR TCTGATATCCAGAATCTAGA AGG Intergenic
No off target data available for this crispr