ID: 1151423929

View in Genome Browser
Species Human (GRCh38)
Location 17:74017373-74017395
Sequence CTGCCTTGGAGGCCCGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151423929_1151423934 9 Left 1151423929 17:74017373-74017395 CCTTGGCCGGGCCTCCAAGGCAG No data
Right 1151423934 17:74017405-74017427 ACCTCCCCACCCCTGACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151423929 Original CRISPR CTGCCTTGGAGGCCCGGCCA AGG (reversed) Intergenic
No off target data available for this crispr