ID: 1151426253

View in Genome Browser
Species Human (GRCh38)
Location 17:74032799-74032821
Sequence TGGTTGAACTGGAGGGAAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151426253_1151426267 5 Left 1151426253 17:74032799-74032821 CCGACTTCCCTCCAGTTCAACCA No data
Right 1151426267 17:74032827-74032849 GCCGGCAGGGTAGGTGGGAAAGG No data
1151426253_1151426265 -1 Left 1151426253 17:74032799-74032821 CCGACTTCCCTCCAGTTCAACCA No data
Right 1151426265 17:74032821-74032843 AGGGAGGCCGGCAGGGTAGGTGG No data
1151426253_1151426271 12 Left 1151426253 17:74032799-74032821 CCGACTTCCCTCCAGTTCAACCA No data
Right 1151426271 17:74032834-74032856 GGGTAGGTGGGAAAGGGACAGGG No data
1151426253_1151426262 -8 Left 1151426253 17:74032799-74032821 CCGACTTCCCTCCAGTTCAACCA No data
Right 1151426262 17:74032814-74032836 TTCAACCAGGGAGGCCGGCAGGG No data
1151426253_1151426269 6 Left 1151426253 17:74032799-74032821 CCGACTTCCCTCCAGTTCAACCA No data
Right 1151426269 17:74032828-74032850 CCGGCAGGGTAGGTGGGAAAGGG No data
1151426253_1151426266 0 Left 1151426253 17:74032799-74032821 CCGACTTCCCTCCAGTTCAACCA No data
Right 1151426266 17:74032822-74032844 GGGAGGCCGGCAGGGTAGGTGGG No data
1151426253_1151426263 -4 Left 1151426253 17:74032799-74032821 CCGACTTCCCTCCAGTTCAACCA No data
Right 1151426263 17:74032818-74032840 ACCAGGGAGGCCGGCAGGGTAGG No data
1151426253_1151426270 11 Left 1151426253 17:74032799-74032821 CCGACTTCCCTCCAGTTCAACCA No data
Right 1151426270 17:74032833-74032855 AGGGTAGGTGGGAAAGGGACAGG No data
1151426253_1151426261 -9 Left 1151426253 17:74032799-74032821 CCGACTTCCCTCCAGTTCAACCA No data
Right 1151426261 17:74032813-74032835 GTTCAACCAGGGAGGCCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151426253 Original CRISPR TGGTTGAACTGGAGGGAAGT CGG (reversed) Intergenic
No off target data available for this crispr