ID: 1151426710

View in Genome Browser
Species Human (GRCh38)
Location 17:74035409-74035431
Sequence CCCATTCGACAGCAGGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151426710_1151426715 1 Left 1151426710 17:74035409-74035431 CCTCAGCCCTGCTGTCGAATGGG No data
Right 1151426715 17:74035433-74035455 TTTACTACTTAGGTGCTGCAAGG No data
1151426710_1151426714 -9 Left 1151426710 17:74035409-74035431 CCTCAGCCCTGCTGTCGAATGGG No data
Right 1151426714 17:74035423-74035445 TCGAATGGGTTTTACTACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151426710 Original CRISPR CCCATTCGACAGCAGGGCTG AGG (reversed) Intergenic
No off target data available for this crispr