ID: 1151426736

View in Genome Browser
Species Human (GRCh38)
Location 17:74035574-74035596
Sequence ATCCCAAGGAACCACAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151426736_1151426742 14 Left 1151426736 17:74035574-74035596 CCTTCACTGTGGTTCCTTGGGAT No data
Right 1151426742 17:74035611-74035633 ACAGTGGGCAGGTGTAGCATTGG No data
1151426736_1151426740 -1 Left 1151426736 17:74035574-74035596 CCTTCACTGTGGTTCCTTGGGAT No data
Right 1151426740 17:74035596-74035618 TGAAATGAGCAAGGCACAGTGGG No data
1151426736_1151426739 -2 Left 1151426736 17:74035574-74035596 CCTTCACTGTGGTTCCTTGGGAT No data
Right 1151426739 17:74035595-74035617 ATGAAATGAGCAAGGCACAGTGG No data
1151426736_1151426737 -10 Left 1151426736 17:74035574-74035596 CCTTCACTGTGGTTCCTTGGGAT No data
Right 1151426737 17:74035587-74035609 TCCTTGGGATGAAATGAGCAAGG No data
1151426736_1151426741 3 Left 1151426736 17:74035574-74035596 CCTTCACTGTGGTTCCTTGGGAT No data
Right 1151426741 17:74035600-74035622 ATGAGCAAGGCACAGTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151426736 Original CRISPR ATCCCAAGGAACCACAGTGA AGG (reversed) Intergenic