ID: 1151427276

View in Genome Browser
Species Human (GRCh38)
Location 17:74039177-74039199
Sequence GAGCCTGCCCACTGCTTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151427271_1151427276 13 Left 1151427271 17:74039141-74039163 CCCCATTTTAAATTGGGCTCTAC No data
Right 1151427276 17:74039177-74039199 GAGCCTGCCCACTGCTTTCAGGG No data
1151427266_1151427276 23 Left 1151427266 17:74039131-74039153 CCACACCCGGCCCCATTTTAAAT No data
Right 1151427276 17:74039177-74039199 GAGCCTGCCCACTGCTTTCAGGG No data
1151427273_1151427276 11 Left 1151427273 17:74039143-74039165 CCATTTTAAATTGGGCTCTACCA No data
Right 1151427276 17:74039177-74039199 GAGCCTGCCCACTGCTTTCAGGG No data
1151427265_1151427276 26 Left 1151427265 17:74039128-74039150 CCACCACACCCGGCCCCATTTTA No data
Right 1151427276 17:74039177-74039199 GAGCCTGCCCACTGCTTTCAGGG No data
1151427269_1151427276 18 Left 1151427269 17:74039136-74039158 CCCGGCCCCATTTTAAATTGGGC No data
Right 1151427276 17:74039177-74039199 GAGCCTGCCCACTGCTTTCAGGG No data
1151427272_1151427276 12 Left 1151427272 17:74039142-74039164 CCCATTTTAAATTGGGCTCTACC No data
Right 1151427276 17:74039177-74039199 GAGCCTGCCCACTGCTTTCAGGG No data
1151427270_1151427276 17 Left 1151427270 17:74039137-74039159 CCGGCCCCATTTTAAATTGGGCT No data
Right 1151427276 17:74039177-74039199 GAGCCTGCCCACTGCTTTCAGGG No data
1151427274_1151427276 -9 Left 1151427274 17:74039163-74039185 CCAACTATGTAGCTGAGCCTGCC No data
Right 1151427276 17:74039177-74039199 GAGCCTGCCCACTGCTTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151427276 Original CRISPR GAGCCTGCCCACTGCTTTCA GGG Intergenic