ID: 1151431330

View in Genome Browser
Species Human (GRCh38)
Location 17:74065491-74065513
Sequence GCCTGACCCCTCTTCTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151431330_1151431338 17 Left 1151431330 17:74065491-74065513 CCAACCAAGAAGAGGGGTCAGGC No data
Right 1151431338 17:74065531-74065553 GCACTTGTACCATAAGTTGTGGG No data
1151431330_1151431339 18 Left 1151431330 17:74065491-74065513 CCAACCAAGAAGAGGGGTCAGGC No data
Right 1151431339 17:74065532-74065554 CACTTGTACCATAAGTTGTGGGG No data
1151431330_1151431337 16 Left 1151431330 17:74065491-74065513 CCAACCAAGAAGAGGGGTCAGGC No data
Right 1151431337 17:74065530-74065552 TGCACTTGTACCATAAGTTGTGG No data
1151431330_1151431341 28 Left 1151431330 17:74065491-74065513 CCAACCAAGAAGAGGGGTCAGGC No data
Right 1151431341 17:74065542-74065564 ATAAGTTGTGGGGTCTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151431330 Original CRISPR GCCTGACCCCTCTTCTTGGT TGG (reversed) Intergenic
No off target data available for this crispr