ID: 1151431333

View in Genome Browser
Species Human (GRCh38)
Location 17:74065522-74065544
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151431333_1151431341 -3 Left 1151431333 17:74065522-74065544 CCCCCAAATGCACTTGTACCATA No data
Right 1151431341 17:74065542-74065564 ATAAGTTGTGGGGTCTCTCCAGG No data
1151431333_1151431342 8 Left 1151431333 17:74065522-74065544 CCCCCAAATGCACTTGTACCATA No data
Right 1151431342 17:74065553-74065575 GGTCTCTCCAGGCACCGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151431333 Original CRISPR TATGGTACAAGTGCATTTGG GGG (reversed) Intergenic
No off target data available for this crispr