ID: 1151431338

View in Genome Browser
Species Human (GRCh38)
Location 17:74065531-74065553
Sequence GCACTTGTACCATAAGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151431330_1151431338 17 Left 1151431330 17:74065491-74065513 CCAACCAAGAAGAGGGGTCAGGC No data
Right 1151431338 17:74065531-74065553 GCACTTGTACCATAAGTTGTGGG No data
1151431331_1151431338 13 Left 1151431331 17:74065495-74065517 CCAAGAAGAGGGGTCAGGCAGCC No data
Right 1151431338 17:74065531-74065553 GCACTTGTACCATAAGTTGTGGG No data
1151431332_1151431338 -8 Left 1151431332 17:74065516-74065538 CCAAAGCCCCCAAATGCACTTGT No data
Right 1151431338 17:74065531-74065553 GCACTTGTACCATAAGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151431338 Original CRISPR GCACTTGTACCATAAGTTGT GGG Intergenic
No off target data available for this crispr