ID: 1151431341

View in Genome Browser
Species Human (GRCh38)
Location 17:74065542-74065564
Sequence ATAAGTTGTGGGGTCTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151431331_1151431341 24 Left 1151431331 17:74065495-74065517 CCAAGAAGAGGGGTCAGGCAGCC No data
Right 1151431341 17:74065542-74065564 ATAAGTTGTGGGGTCTCTCCAGG No data
1151431334_1151431341 -4 Left 1151431334 17:74065523-74065545 CCCCAAATGCACTTGTACCATAA No data
Right 1151431341 17:74065542-74065564 ATAAGTTGTGGGGTCTCTCCAGG No data
1151431333_1151431341 -3 Left 1151431333 17:74065522-74065544 CCCCCAAATGCACTTGTACCATA No data
Right 1151431341 17:74065542-74065564 ATAAGTTGTGGGGTCTCTCCAGG No data
1151431336_1151431341 -6 Left 1151431336 17:74065525-74065547 CCAAATGCACTTGTACCATAAGT No data
Right 1151431341 17:74065542-74065564 ATAAGTTGTGGGGTCTCTCCAGG No data
1151431335_1151431341 -5 Left 1151431335 17:74065524-74065546 CCCAAATGCACTTGTACCATAAG No data
Right 1151431341 17:74065542-74065564 ATAAGTTGTGGGGTCTCTCCAGG No data
1151431330_1151431341 28 Left 1151431330 17:74065491-74065513 CCAACCAAGAAGAGGGGTCAGGC No data
Right 1151431341 17:74065542-74065564 ATAAGTTGTGGGGTCTCTCCAGG No data
1151431332_1151431341 3 Left 1151431332 17:74065516-74065538 CCAAAGCCCCCAAATGCACTTGT No data
Right 1151431341 17:74065542-74065564 ATAAGTTGTGGGGTCTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151431341 Original CRISPR ATAAGTTGTGGGGTCTCTCC AGG Intergenic
No off target data available for this crispr