ID: 1151431342

View in Genome Browser
Species Human (GRCh38)
Location 17:74065553-74065575
Sequence GGTCTCTCCAGGCACCGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151431332_1151431342 14 Left 1151431332 17:74065516-74065538 CCAAAGCCCCCAAATGCACTTGT No data
Right 1151431342 17:74065553-74065575 GGTCTCTCCAGGCACCGTCCAGG No data
1151431336_1151431342 5 Left 1151431336 17:74065525-74065547 CCAAATGCACTTGTACCATAAGT No data
Right 1151431342 17:74065553-74065575 GGTCTCTCCAGGCACCGTCCAGG No data
1151431340_1151431342 -10 Left 1151431340 17:74065540-74065562 CCATAAGTTGTGGGGTCTCTCCA No data
Right 1151431342 17:74065553-74065575 GGTCTCTCCAGGCACCGTCCAGG No data
1151431333_1151431342 8 Left 1151431333 17:74065522-74065544 CCCCCAAATGCACTTGTACCATA No data
Right 1151431342 17:74065553-74065575 GGTCTCTCCAGGCACCGTCCAGG No data
1151431335_1151431342 6 Left 1151431335 17:74065524-74065546 CCCAAATGCACTTGTACCATAAG No data
Right 1151431342 17:74065553-74065575 GGTCTCTCCAGGCACCGTCCAGG No data
1151431334_1151431342 7 Left 1151431334 17:74065523-74065545 CCCCAAATGCACTTGTACCATAA No data
Right 1151431342 17:74065553-74065575 GGTCTCTCCAGGCACCGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151431342 Original CRISPR GGTCTCTCCAGGCACCGTCC AGG Intergenic
No off target data available for this crispr