ID: 1151432401

View in Genome Browser
Species Human (GRCh38)
Location 17:74072377-74072399
Sequence CCTCAGAGGCACAGGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151432401_1151432412 24 Left 1151432401 17:74072377-74072399 CCTTCTCCCCTGTGCCTCTGAGG No data
Right 1151432412 17:74072424-74072446 TTATAAGGACACATGTCAATGGG No data
1151432401_1151432411 23 Left 1151432401 17:74072377-74072399 CCTTCTCCCCTGTGCCTCTGAGG No data
Right 1151432411 17:74072423-74072445 CTTATAAGGACACATGTCAATGG No data
1151432401_1151432408 9 Left 1151432401 17:74072377-74072399 CCTTCTCCCCTGTGCCTCTGAGG No data
Right 1151432408 17:74072409-74072431 CTCTCAGCCTTTTCCTTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151432401 Original CRISPR CCTCAGAGGCACAGGGGAGA AGG (reversed) Intergenic
No off target data available for this crispr